Batch Pure culture fermentation growth assay assays

Preparing to load PDF file. please wait...

0 of 0
100%
Batch Pure culture fermentation growth assay assays

Transcript Of Batch Pure culture fermentation growth assay assays

Electronic Supplementary Material (ESI) for Food & Function. This journal is © The Royal Society of Chemistry 2021

Batch fermentation
assay

to investigate the ability of the bioactives to alter the overall composition and/or SCFA production
of faecal microbiota

Pure culture growth assays

to determine if the bioactives can directly
stimulate/inhibit important microbial
species

Figure S1. An outline of the experimental processes of this study.

Identification of dietary
supplements for animal and human
applications

Table S1. List of 16S rRNA regions incorporated into plasmids for the preparation of specific Escherichia coli clones used for the quantification of Lactobacillus spp., total bacteria, Enterobacteriaceae, Bifidobacterium spp. and Prevotella spp.

Bacterial group Lactobacillus spp. Total Bacteria Enterobacteriaceae Bifidobacterium spp. Prevotella spp.

GenBank I.D. (for purposes of alignment) CP017124.1 CP033387.1 CP041955.1
CP016019.1
CP024730.1

Region aligned
367650367990 11951411195413 483389483554 23280422328627 23283682328244 246704246191

Description

Primer Pairs

Cloned Fragment and QPCR amplicon Cloned Fragment and QPCR amplicon Clone Fragment and QPCR amplicon
Cloned Fragment
QPCR amplicon located within the cloned fragment Cloned Fragment and QPCR amplicon

F: AGCAGTAGGGAATCTTCCA R: CACCGCTACACATGGAG F: GTGCCAGCMGCCGCGGTAA R: GACTACCAGGGTATCTAAT F: ATGTTACAACCAAAGCGTACA R: TTACCYTGACGCTTAACTGC F: GCAATATTCCCCACTGCTGC R: GGTGTGGTGGTGGTTTGAGA F: GCGTGCTTAACACATGCAAGTC R: CACCCGTTTCCAGGAGCTATT F: CACRGTAAACGATGGATGCC R: GGTCGGGTTGCAGACC

Tm (°C)
54.5 55.2 64.2 52.4 54 56.3 59.3 59.3 60.3 59.8 58.3 56.9

Amplicon length (bp) 341 291 185 586 125 514

bp, base pairs; Tm, melting temperature.

Table S2. Health-associated characteristics of the bacterial strains used in the pure culture growth assays.

Bacterial Strain

Beneficial properties

Disease

Pig

Human

Lactobacillus plantarum

Antimicrobial activity against Adhesive properties

N/A

enteropathogens

Antibacterial activity against enteropathogens

Increase of other lactobacilli and IL-10 upregulation

butyrate-producing clostridia

Anti-tumour activity

Reduction of Enterobacteriaceae and Hypocholesteromic activity

ETEC-induced diarrhea

Improved nutrient digestibility

Inhibition of β-glycoronidase activity

(carcinogenesis)

Lactobacillus reuteri

Adhesive properties

Adhesive properties

N/A

Antimicrobial activity against Antimicrobial activity against enteropathogens

enteropathogens

Inhibition of EPEC adhesion

Increase of other lactobacilli

Antiviral activity against Coxsackieviruses type A

Reduction of Enterobacteriaceae

and Enterovirus 71

Inhibition of β-glycoronidase activity

(carcinogenesis)

Increased adaptation to starch

fermentation

References
63, 65, 68, 74, 87-89
63, 66, 71, 73, 74, 87, 90-93

Bifidobacterium thermophilum

Strong anti-Brachyspira activity

Enterotoxigenic Escherichia N/A coli O149A+:K91:F4
Salmonella Typhimurium N/A PT12 N/A, Not Applicable.

Adhesive properties Inhibition of Listeria monocytogenes invasion in host cells S. Typhimurium inhibition and interference with virulence factors expression Enhanced epithelial integrity during S. Typhimurium infection Antiviral activity against Rotavirus and reduced disease severity and duration N/A
N/A

N/A

Pig:

significant

mortality,

postweaning diarrhoea

Human: no reported disease in

humans

Pig: enterocolitis, septicaemia

Humans: gastroenteritis

64, 66, 67, 70, 75, 94
83, 95 82, 96
FragmentEnterobacteriaceaeActivityCulture Growth AssaysCarcinogenesis